Clicky

How to use Berberine to Boost Weight Loss, Lower Blood Sugar & More

 

Berberine might just be one of the best supplements you’ve never heard of.

Elevated blood sugar levels damage the body’s tissues and organs leading to a variety of health problems, poor quality of life, and shortened lifespan.

We strongly believe a low carb diet like the Keto diet, along with increased exercise is the most effective means of combatting high blood sugar, metabolic syndrome, diabetes and related disease.

However, many people are not able to control their blood sugar levels with diet and exercise alone and turn to prescriptions medications from their doctor.

The most commonly used prescription drug for high blood sugar is metformin (Glucophage)

Works as well as Metformin
A review of the 14 most relevant studies that found berberine works as well as the most commonly prescribed diabetes drugs metformin, rosiglitazonem and glipizide (10, 11,15).

Berberine seems to work via multiple different mechanisms (12):

  • Decreases insulin resistance, so it is more effective at lowering blood sugar levels
  • Increases glycolysis inside the cells
  • Signals the liver to decrease glucose production.
  • Slows the breakdown of carbohydrates in the gut.
  • Increases the number of beneficial bacteria in the gut.

Remarkable as it seems that it acts in all these pathways, also seems to affect various other enzymes, molecules and genes related to blood sugar control.

Normalized Blood Sugar Levels
116 diabetic patients given 1 gram of berberine per day for 3 months.

These patients experienced fasting blood sugar levels lowered to normal levels, from 126 to 101 mg/dL (13).

Lowers Bad Cholesterol Levels
These same 116 patients experienced A1c levels lowered by 12% on average, and greatly lowered levels of cholesterol and triglycerides.

Triglyceride decreased from 2.51 to 1.61, total cholesterol from 5.31 to 4.35, and LDL cholesterol. from 3.23 to 2.55 mm/liter. (14).

 

Berberine has been found to work well with other interventions such as reduced calorie diets and exercise, and has synergistic effects when taking with other diabetes medications (16).

Conclusion: Berberine is very effective at lowering blood sugar level

INCREASED NAD+ AND AMPK – THE METABOLIC MASTER SWITCH

ampk enzymeWhen ingested, it travels thru the blood to cells and binds to several different molecules to actually change their function (5). This is similar to how pharmaceutical drugs work.

The different mechanisms of berberine are complicated, but one of the main functions is to activate the AMPK enzyme (6).

Referred to as a “metabolic master switch” (6), AMPk is found in the cells of the brain, muscle, kidney, heart and liver. It helps regulate metabolism (7, 8).

Berberine also affects other molecules in the cells, and is even thought to determine which genes in the cells are turned on or off (9).

This study showed the activation of AMPK resulted in increased NAD+ levels, mitochondria biogenesis, weight loss, and increased muscle fibers.

Further exploration of the mechanism that berberine and metformin utilized for elevating AMPK and NAD+ was shown in this study.

Conclusion: Berberine acts at the molecular level activating the AMPK enzyme, which increases metabolism.

Berberine and Weight Loss

weight loss chart

2 recent studies found positive results for weight loss with supplementation of Berberine.

In a 12 week long study of obese individuals that were given 500 mg of berberine 3 times a day, they lost an average of 5 pounds, and 3.6% of their body fat (17).

The second study was for 3 months, during which 37 individuals with metabolic syndrome were given 300 mg of berberine 3 times per day. These patients saw their body mass index (BMI) drop from 31.5 to 27.4, lost significant amounts of belly fat, and saw improvement in several other markers of health (18).

Improved insulin resistance and regulation of hunger hormones adiponectin and leptin were believed to be responsible for the positive results in this study.

Other studies at the molecular level have shown Berberine changes the expression of PPARgamma2 mRNA genes to inhibit formation of adipocytes (fat cells) (19, 20).

Conclusion: Studies have shown that berberine can cause significant weight loss, belly fat, improve BMI and other health markers.

 

wwrecommend

SIDE EFFECTS and DOSAGE

As fantastic as Berberine is, the main problem it has is bioavailability. One of our bodies main defense mechanisms, P-Glycoproteins, bind with foreign objects in the small intestine and carries them away.

Unfortunately it does a great job of stopping the absorption of beneficial plant based compounds like Curcumin and Berberine. The result is very low absorption rates of 5% or less, meaning we have to take a LOT more than what our bodies actually use.

Your body has to process and excrete a LOT of Berberine

Too much Berberine can lead to mild side effects such as:

  • gas
  • cramping
  • bloating

These minor discomforts appear at higher dosages only, so you should start slowly and work your way up

Also, some potential interactions with other medications:

  • Berberine is known to inhibit CYP2D6, CYP2C9, and CYP3A4, which can lead to a host of drug interactions, some of which can be serious
  • Berberine may interact with microlide antibiotics such as azithromycin and clarithromycin at hERG channels on the heart, leading to serious cardiotoxicit

Most research has used 4-500mg dosage, taken 2 -3 times a day.  Higher dosages are more effective, but tend to result in more Gastro-Intestinal issues.

Improved Bioavailability

Higher bioavailability would allow a smaller dosage to get the same effect without risk of side effects.

The product we recommend above, Protocol for Life, uses MCT oil which has been shown to increase bioavailability and avoid GI issues (21,22,23)

 

Berberine has been used for thousands of years in Chinese and Native American medicine

chinese medicineBerberine has been used for centuries in Chinese medicine and by Native American Indians, yet has only recently been “discovered” by western medicine.

With our heavy emphasis on corporate profits driven by man-made, patented medicines, we often are late in learning about natural products such as Berberine and Niagen, but rest assured you will be hearing about it more in the future.

Berberine is now being studied extensively and has been proven to lower blood sugar as well as the most commonly prescribed prescription drug metformin (1, 2), aid in weight loss, improve heart health, and several other benefits (3)

patients had improved strength, and had lower blood pressure with declining blood glucose levels

Here are just some of the things research is now proving Berberine is able to help with.

  • Significantly Lowers blood sugar levels
  • Aids in Weight Loss
  • Improves Heart Health
  • Lowers Cholesterol
  • Decrease belly fat
  • Improve Immune System
  • Anti-oxident and Anti-Inflammatory
  • Lower Blood Triglyceride levels
  • Help fight Cancer
  • Fight Depression
Conclusion: Berberine has a long history of use for an amazing array of health issues that are now being “discovered” and used by western medicine

 

What is Berberine?

Berberine is the active ingredient in a several different plants that have been used in natural remedies for centuries, such as Goldenseal (Hydrastis canadensis), Oregon grape (Berberis aquifolium), Barberry (Berberis vulgaris), and Chinese Goldthread (Coptis chinensis) (4).

An alkaloid, it has a yellow color, and has often been used as a dye.

Berberine Lowers Cholesterol and May Reduce Your Risk of Heart Disease

Heart and Stethoscope
Berberine has been shown to improve many of the factors that lead to heart disease.

This review (21) of 11 different studies show that Berberine can:

  • Lower blood triglycerides by 44 mg/dL.
  • Lower LDL (bad) cholesterol by 25 mg/dL.
  • Raise HDL (good) cholesterol by 2 mg/dL.
  • Lower total cholesterol by 24 mg/dL.

Berberine also lowers apolipoprotein B by 13-15%, which is a big risk factor for cardiovascular disease (22, 23).

Conclusion: Berberine reduces cholesterol and triglyceride levels, while raising the good HDL cholesterol, and may lower the risk of heart disease.

 

Other Health Benefits

Berberine may also have numerous other health benefits:

  • Cancer:These studies (26, 27)
    seem to indicate that Berberine plays a role in reducing the growth of different types of cancer
  • Depression: These studies with rats (24, 25, 26) show that Berberine may lessen depression
  • Infections: These studies(27, 28, 29, 30)show Berberine fights harmful bacteria, viruses, fungi and parasites
  • Antioxidant and Anti-Inflammatory: These studies (31, 32, 33) indicate Berberine has strong antioxidant and anti-inflammatory effects
Conclusion: Berberine is a strong anti-oxidant and anti-inflammatory, and may help fight depression, infections, heart disease and even cancer

 

Side Effects

thumbs upOverall, berberine is very safe with the main side effects being indigestion, and possible cramping, diarrhea, flatulence, constipation and stomach pain (10).

An average dosage used in many studies are 900 to 1500 mg per day.

Berberine has a half-life of about 4 hours, so you do need to take it more than once a day.

It is common to take 500 mg, 3 times per day.

If you have a medical condition, you should speak to your doctor before taking berberine, especially if you are taking blood sugar lowering medications.

Conclusion: Some people may experience mild side effects with Berberine. The normal recommended dosage is 500 mg 3 times per day before meals.

 

The Bottom Line

There is no such thing as a magic weight loss supplement or medication.

There are however many medications and supplements that can help.

You just need to make sure that you are using the right dose for your body.

Berberine is one of very few supplements that are as powerful as a prescription drug.

It has numerous beneficial effects, most notably blood sugar control.

It is also be useful for general health, fighing chronic disease, and anti-aging.

If you need some help controlling your weight, blood sugar levels or want to improve your heart and overall health, Berberine may be right for you.

Remember that you may need to use berberine for as long as 6+ months to get the full benefit, and dosages up to 2,000mg per day may be necessary.

 

 

 

 

 

New Study that need to be folded in to this article

Berberine protects against diet-induced obesity through regulating metabolic endotoxemia and gut hormone levels.

1. Introduction
The human gut microbiota has recently been considered an important factor in modulating body health and might be closely associated with the pathogenesis of obesity, diabetes, inflammation, cardiovascular diseases, and other diseases [1-4].
Fecal microbiota transplantations have been used in clinics for the treatment of patients with chronic gastrointestinal infections and inflammatory bowel diseases because the intestinal bacteria release certain therapeutic metabolites that suppress inflammation in the gastroenterological tract [5-7]. For energy metabolism, gut bacteria could, for instance, benefit host metabolic efficiency by producing short-chain fatty acids (SCFAs) through bacterial fermentation [8].

Importantly, the nature of the gut microbiota, such as its composition, enzyme activity, and metabolite production, can be manipulated by controllable factors, such as drugs, diet, and lifestyle, offering a possible approach to treat diseases through regulating bacterial fermentation in the intestines. We focused our research on the metabolite profile of the gut microbiota after exposure to the botanical drug berberine (Berberine, Fig. 1A), and moreover, the metabolite’s production regulation.

SCFAs are small molecular weight compounds derived from the intestinal microbiota through fermentation of the fibrous diet and could be rapidly absorbed to enter the blood and organs [9, 10]. Chemically, there are 1–6 carbon atoms in SCFAs structures, which are presented in a straight or branched conformation [11]. The beneficial bioactivity of SCFAs includes those on energy metabolism, anti-inflammation, and immune regulation [2, 12, 13]. The major SCFAs are acetate, propionate and butyrate. Among these SCFAs, butyrate, which could be readily detected in feces and blood via gas chromatography (GC), is the primary energy source and has been widely documented with regard to human health (Fig. 1A & B) [14].

Bacterial butyrate is mainly synthesized through the acetyl CoA-butyryl CoA-butyrate pathway, in which the key enzymes are regulated based on the level of ATP and NADH [15, 16]. Chemicals that interfere with the ATP production or NADH level in bacteria might in turn regulate the level of SCFAs in intestinal microbiota.

We previously reported that Berberine (Fig. 1A) could safely lower blood lipid and glucose levels, and its therapeutic efficacy has been verified in clinics [17-21]. The mechanism of Berberine is different from that of statins [17, 22] and links to its regulatory effect on cellular targets such as low-density lipoprotein receptor (LDLR) [17], insulin receptor (InsR) [23], AMP-activated protein kinase (AMPK) [24], proprotein convertase subtilisin kexin 9 (PCSK9) [25], protein tyrosine phosphatase 1B (PTP1B) [26], mitochondrial ATP production [27], and brown fat tissue [28].

Thus, Berberine is considered a multi-target drug with significant advantages [22, 29]. Berberine administered orally enters the blood after a structural transformation by nitroreductases from bacteria in the gut [30]. However, the bioavailability of Berberine is poor and a large portion of it (over 90%) remains in the intestines [31, 32]. Recent studies have shown that Berberine might modulate the composition of the intestinal bacterial community [33], suggesting that the intestinal microbiota might also be involved in its regulation of energy metabolism.

In this study, we show that Berberine enriched butyrate-producing bacteria in the gut microbiota, and through the acetyl CoA-butyryl CoA-butyrate pathway Berberine promotes the gut microbiota to synthesize butyrate, which then enters the blood and causes a reduction in blood lipid and glucose levels. This mode of action—that is, working through the gut microbiota—appeared to be independent of the direct cellular mechanism of Berberine. We, therefore, speculated that regulating the production of bioactive metabolites in the gut microbiota might be a novel treatment strategy.

2. Materials and Methods
2.1. Chemicals and reagents
Berberine, butyric acid, sodium butyrate, valeric acid, isovaleric acid, and acetone were obtained from the J&K Scientific Ltd. (Beijing, China). Propionate acid, sodium propionate, acetic acid, and isobutyric acid were from the Sigma-Aldrich Co. (Shanghai, China). Tetrahydropalmatine (the internal standard) was purchased from the National Institute for Food and Drug Control (Beijing, China). The purity of the above standards was all over 98% in HPLC. Other chemical reagents from the Sinopharm Chemical Reagent Co., Ltd. (Beijing, China) were all at chromatographic grade purity.
Total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and fasting blood glucose (FBG) detection kits were obtained from the BioSino 7

Bio-technology & Science Inc. (Beijing, China). The ATP and NAD+/NADH assay kits were purchased from the BioAssay Systems (Hayward, CA, USA), and the rat AMP ELISA kit was obtained from the TSZ biological Trade Co., Ltd. (North Brunswick, NJ, USA). Acetyl-CoA and butyryl-CoA were both purchased from the Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China).
Cefadroxil was purchased from the National Institute for Food and Drug Control (Beijing, China). Terramycin and erythromycin were from the J&K Scientific Ltd (Beijing, China).

2.2. Animals
Sprague–Dawley (SD) rats (180–200 g, male) and hamsters (140–160 g, male) were supplied by the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (Beijing, China). The ob/ob mice (40–50 g) were obtained from the Beijing HFK Bioscience Co. Ltd. (Beijing, China). Animals were housed in SPF-grade rooms and had free access to food and water, with a 12 h light/dark cycle (light on from 8:00 AM to 8:00 PM) at ambient temperature (22–24 C) and 45% relative humidity.
The research was conducted in accordance with institutional guidelines and ethics and approved by the Laboratories Institutional Animal Care and Use Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College.
2.3. Instruments

Liquid chromatography with tandem mass spectrometry (LC-MS/MS 8050, Shimadzu Corporation, Kyoto, Japan) was used for the analysis and quantification of Berberine and its metabolites in biological samples. LC separation was achieved using a Shim-pack XR-ODS II column (75 mm × 3 mm × 2.3 μm, Shimadzu Corporation, Kyoto, Japan) maintained at 40 

C. The mobile phase consisted of water-formic acid (100:0.5, v/v) and acetonitrile with a linear gradient elution (0 min, 90:10; 3.5 min, 75:25; 5.0 min, 70:30; 5.01 min, 80:20; 6.0 min, 90:10) at a flow rate of 0.4 mL/min during the entire gradient cycle. Shimadzu LCMS solution (Version 5.72) was used for data acquisition and processing. For positive ESI analysis, the parameters were as follows: nebulizer gas, 3 L/min; drying gas, 10.0 L/min; interface, -4.5 kV; CID gas, 230 kPa; DL temperature and heat block temperature were maintained at 250 and 400 C, respectively. The quantification was carried out using multiple reaction monitoring modes (MRM). The m/z transitions were 335.8→320.0 (m/z) for Berberine, and 356.0→192.0 (m/z) for the internal standard (IS).

The peak areas of Berberine in fluid samples and the internal standard were recorded respectively. LC-MS/MS was also used for the analysis of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA. The m/z transitions were 810.5→303.5 (m/z) for acetyl-CoA, 851.6→345.2 (m/z) for acetoacetyl-CoA, 853.6→347.2 (m/z) for β-hydroxyl butyryl-CoA, 835.6→329.2 (m/z) for crotonyl-CoA, and 837.6→331.2 (m/z) for butyryl-CoA.
GC-2014 (Shimadzu Cooperation, Kyoto, Japan) was applied to analyze and quantify SCFAs. It was equipped with a flame ionization detector and an Alltech capillary column (AT-WAX, 30 m × 0.25 mm × 0.25 μm, Alltech company, ME, USA) operated in the splitless mode. The helium carrier flow was 37.0 cm/s under a column head pressure of 68.0 kPa. The oven temperature was initially 80 C for 1 min, which was gradually increased to 130 C at a rate of 5 C/min and maintained for 5 min. The injector and detector temperatures were set at 230 C and 250 C, respectively.

2.4. Berberine-mediated butyrate production in intestinal bacteria of the SD rats
A series of butyrate working solutions were prepared at concentrations of 1, 2, 10, 20, 200, and 500 μg/mL by diluting the stock solution (1 mg/mL) with purified water. Then, 50 μL of these solutions were further diluted with 50 μL of acetone. An aliquot of 1 μL of the solutions was injected into the GC-2014 for analysis and a standard curve of butyrate was subsequently created.

Colon contents from six SD rats were pooled, and 2 g of the mixture of colon contents was transferred into a flask containing 40 mL normal saline. After mixing thoroughly, the cultures were pre-incubated under anaerobic conditions with a N2 atmosphere at 37 C for 60 min. Berberine (10 μL) at different concentrations was added to the rat intestinal bacteria cultures (990 μL), with saline (10 μL) as a negative control. The final concentrations of Berberine in the incubation system were 10 and 20 g/mL, respectively. The cultures were incubated for 6, 12, and 24 h at 37

C. At the same time, an equal amount of intestinal bacteria was inactivated through boiling. After termination of the reaction with acetonitrile (1 mL), the incubation was mixed for 30 s and centrifuged at 14,800 rpm for 10 min. The supernatant (100 μL) was transferred into an Eppendorf tube with 100 μL of acetone and centrifuged at 10,000 rpm for 5 min after mixing thoroughly. An aliquot of 1 μL supernatant was injected into the GC-2014 for butyrate analysis.

2.5. Butyrate production by Berberine in intestinal bacteria strains in vitro
Eight intestinal facultative anaerobes were incubated under anaerobic conditions with Berberine at a final concentration of 10 μg/mL for 24 h, including Enterococcus faecium (E. faecium) ATCC 35667, Enterococcus faecalis (E. faecalis) ATCC 29212, Escherichia coli (E. coli) ATCC 25922, Bifidobacterium longum (B. longum) ATCC 15707, Bifidobacterium breve (B. breve) ATCC 15700, Lactobacillus acidophilus (L. acidophilus) ATCC 4356, Lactobacillus casei (L. casei) ATCC 334, and Clostridium butyricum (C. butyricum) ATCC 19398 from Guangdong Huankai Microbial Sci,. & Tech. Co., Ltd. (Guangdong, China). The sample processing procedures were identical to those previously mentioned. Butyrate was quantitatively analyzed using a GC-2014.

2.6. Hamsters with a high-fat diet
A high-fat diet (HFD) was used to induce hyperlipidemia in hamsters in an SPF-grade room. The HFD was made of 1.0% cholesterol, 1.0% sodium cholate, 10.0% lard, 5.0% yolk powder, and 0.2% propylthiouracil added to the standard forage. All of the healthy hamsters were fasted overnight before the experiment.

Based on their weights and their serum TC levels, the 42 hamsters were divided into two groups. The first group was a control group (8 hamsters) and the second was the HFD group (34 hamsters). The control group was given a standard diet. Both groups were free to drink water ad libitum. During the modeling period, the hamsters were weighed and their plasma TC, TG, and LDL-C values were determined every 2 weeks.

After 6 weeks, the hamsters were fasted for 12 h before blood samples were taken from the orbital venous plexus. Blood TC, TG, and LDL-C were detected using commercial kits. The hamster hyperlipidemia model was established when blood TC, TG, and LDL-C of the HFD hamsters were significantly higher than that of the control hamsters.

Eight healthy and 34 HFD hamsters were divided into 3 groups: 8 healthy hamsters as the control group (Group 1), 8 HFD hamsters as the HFD control group (Group 2), and 26 HFD hamsters treated with Berberine (100 mg/kg/day) as the treatment group (Group 3). Berberine was given orally once a day for 10 days.

On days 3, 5, 7, and 10 post-treatment, fresh feces was collected and blood was taken from the orbital venous plexus for plasma samples. The samples were stored at -80 C before analysis. The fecal solution was prepared by reconstituting feces in saline (1 g:3 mL), followed by centrifugation at 10,000 rpm for 5 min. Then, 50 μL of acetone was added to 50 μL of the plasma or the fecal solution, mixed thoroughly, and centrifuged at 10,000 rpm for 5 min. An aliquot of 1 μL of the supernatant was injected into the GC-2014 for butyrate (or propionate) analysis.

Blood TC, TG, and LDL-C were detected using commercial kits.
At day 10 after Berberine treatment (100 mg/kg/day, oral), the HFD hamsters were killed, and liver samples were taken and stored at -80 C. After thawing, the liver samples were homogenized with saline in a ratio of 1:2 [weight (g): volume (mL)]. Then, 100 μL of acetone was added to 100 μL of the liver homogenate, mixed thoroughly, and centrifuged at 10,000 rpm for 5 min. An aliquot of 1 μL of the supernatant was injected into the GC-2014 for butyrate analysis.

2.7. Ob/ob mice model
Eighteen ob/ob mice were randomly divided into 3 groups: 6 mice were given a low dose of butyrate treatment (200 mg/kg/d, Group 1), 6 were given a high dose of butyrate (400 mg/kg/d, Group 2), and 6 were given the Berberine treatment (100 mg/kg/d, Group 3). The drugs were administered orally and once a day for 10 days. The levels of TC, TG, and FBG in the ob/ob mice were tested before the experiment. On days 3, 7, and 10 post-treatment, feces and blood samples were taken for butyrate analysis, as well as TC, TG, and FBG detection, using the methods described above.
The ob/ob mice were also used for the Berberine intraperitoneal (ip) injection experiment, in which 12 mice were tested for blood glucose and lipid levels before the experiment. The 12 mice were then grouped, with 6 mice orally treated with Berberine (100 mg/kg/day, Group 1) and the other 6 mice ip treated with Berberine (20 mg/kg/day, Group 2). Berberine was given once a day for 10 days. Butyrate, TC, TG, and FBG were measured in the feces and plasma.

 

2.8. Pseudo-germ-free ob/ob mice model
The plasma glucose and lipid levels of ob/ob mice were tested before the experiment. Then, the 32 ob/ob mice were divided into four groups: 8 were untreated (Group 1), 8 were orally administered Berberine (100 mg/kg/day, Group 2), 8 were orally administered antibiotics only (Group 3), and 8 were orally administered both antibiotics and Berberine (100 mg/kg/day, Group 4). The regimen for antibiotics included cefadroxil (100 mg/kg/day), terramycin (300 mg/kg/day), and erythromycin (300 mg/kg/day).

For the treatment protocol, the ob/ob mice in Group 3 and 4 were orally administered antibiotics twice a day for 3 days to achieve pseudo-germ-free (PGF) status. Then, Berberine was given to the mice in Group 2 and 4 once a day for 10 days; simultaneously, antibiotics were continuously given to the mice in Group 3 and 4.
On days 3, 7 and 10 post-treatment, feces were collected for butyrate analysis as described, and blood samples were taken on day 10 to determine the levels of TC, TG, and FBG.

The colon contents of all ob/ob mice were collected on day 10 post-treatment, and the PGF status was confirmed by culturing the fecal samples anaerobically in a nutrient agar culture medium.

2.9. Influence on LDLR and InsR gene expression in human hepatocytes by butyrate
The HL-7702 cells were obtained from the Institute of Biochemistry and Cell Biology (SIBS, Chinese Academy of Science, Shanghai, China). Cells were cultured in RPMI-1640 medium with 10% FBS, 1% nonessential amino acids, and appropriate antibiotics in an atmosphere of 5% CO2 at 37 C. Cells were trypsinized and grown to about 70–80% confluence, then were starved in 0.5% FBS-containing medium for 24 h before the experiment.

Butyrate was dissolved in sterile saline, and Berberine was reconstituted in DMSO. They were then used to treat the cells for 24 h in 0.5% FBS-containing medium, as indicated. After treatment, total cellular RNA was isolated and reversely transcribed into cDNA by a commercially available kit according to the supplier’s protocol (Promega, CA, USA). Quantitative real-time PCR was performed with gene-specific primers, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control.

 

The sequences of the primers are LDLR upstream, aggacggctacagctaccc, LDLR downstream, ctccaggcagatgttcacg; InsR upstream, gctggattattgcctcaaagg, InsR downstream, tgagaatcttcagactcgaatgg; GAPDH upstream, tccactggcgtcttcacc, GAPDH downstream, ggcagagatgatgaccctttt. The reactions were performed in an ABI Prism 7900 High-Throughput Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), as previously described [23]. The comparative threshold cycle (CT) method was used for relative quantification of target gene expression, which was plotted as the fold change of the control.

2.10. Detection of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA
LC-MS/MS was used for the analysis of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA in the SD intestinal bacteria samples treated with Berberine. The optimized m/z transitions from the mass spectrum were 810.5→303.5 (m/z) for acetyl-CoA, 851.6→345.2 (m/z) for acetoacetyl-CoA, 853.6→347.2 (m/z) for β-hydroxyl butyryl-CoA, 835.6→329.2 (m/z) for crotonyl-CoA, and 837.6→331.2 (m/z) for butyryl-CoA. The fold of control, where the control was normalized as 1, was used to express the change of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, and crotonyl-CoA after Berberine treatment.

The external standard method was adopted for the determination of butyryl-CoA. The stock solution of butyryl-CoA (100 ng/mL) was prepared and stored at 4 C. The working solution was prepared at a series of concentrations of 1, 2, 10, 20, and 50 ng/mL by diluting the stock solution with purified water, from which the standard curve was obtained (r2 > 0.99).
Berberine (at final concentrations of 10 and 20 μg/mL) was incubated with SD intestinal bacteria for 6 or 12 h. Acetonitrile was added to terminate the reactions; the samples were centrifuged at 14,800 rpm for 10 min to obtain the supernatant, which was then dried under a nitrogen flow at room 20-22 C. The residue was dissolved in 100 μL of water and centrifuged at 10,000 rpm for 10 min. Then, the samples were analyzed using the LC-MS/MS 8050.

2.11. ATP, AMP, and NADH/NAD+ ratios in intestinal bacteria
SD intestinal bacteria samples were incubated with Berberine (at final concentrations of 10 and 20 μg/mL) for 6 and 12 h in an anaerobic condition. The treatment was terminated by direct centrifugation at 14,800 rpm for 10 min. Then, the supernatant was stored at 4 C, followed by detection of ATP, AMP, and the ratio of NADH/NAD+. The tests were carried out according to the manufacturer’s instructions in the kits.

2.12. Gene expression of butyrate kinase and butyryl-CoA:acetate-CoA transferase
A quantitative real-time RT-PCR assay method was used to measure the gene expression of butyrate kinase (BUK) and butyryl-CoA:acetate-CoA transferase (BUT). Total RNA was extracted using TRIzol Plus RNA Purification Kit (Invitrogen, CA, USA). A quantitative real-time RT-PCR analysis was performed using the Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems, CA, USA) in an ABI 7500 Fast System.

Briefly, 50 ng of total bacterial RNA was quantified in a 20 μL reaction mixture of the kit. The reaction was carried out with an initial holding (30 min at 48 °C), an initial denaturation (10 min at 95 °C), then 40 cycles of denaturation (15 s at 95 °C), and annealing/elongation (1 min at 50 °C for BUK; 1 min at 45 °C for BUT).

2.13. Bacterial composition analysis
The 16S rRNA genes were amplified using the specific primer of 16S V3-V4: 340F-805R to target the V3-V4 regions of 16S rRNA. PCR products were mixed in equidensity ratios. Then, a mixture of PCR products was purified with a GeneJET Gel Extraction Kit (QIAGEN, Germany). Sequencing libraries were generated by using a NEXTflex Rapid Illumina DNA-seq Kit from New England Biolabs (Ipswich, MA, USA) following manufacturer’s recommendations and adding index codes. The library quality was assessed on a Qubit 2.0 Fluorometer (Thermo Scientific, Carlsbad, CA, USA) and Agilent Bioanalyzer 2100 system (Agilent Technologies, USA).

Finally, the library was sequenced on a HiSeq2500 (Illumina) platform and 250 bp paired-end reads were generated. Sequences were analyzed using the Quantitative Insights Into Microbial Ecology (QIIME) software package. First, the QIIME quality filters categorized the reads. Then, we picked a representative sequence for each operational taxonomic unit (OTU) and used the ribosomal database project classifier to annotate taxonomic information for each representative sequence. Sequences with ≥97% similarity were assigned to the same OTUs.

2.14. Data analysis
Statistical analyses were conducted using a two-way ANOVA and Student’s t-test with GraphPad Prism Version 5 (GraphPad Software, La Jolla, CA, USA). The data are expressed as means ± standard deviation. P values less than 0.05 were considered statistically significant.

3. Results
3.1. Berberine treatment increased butyrate production in intestinal bacteria
SD rat intestinal bacteria (as feces) were collected for an in vitro anaerobic incubation in the presence or absence of Berberine. As shown in Fig. 2A, treating intestinal bacteria with Berberine caused an increased production of butyrate in a dose-dependent manner. The earliest significant increase of butyrate was seen 6 h after Berberine treatment (20 μg/mL) and the elevation remained stable for at least another 18 h (Fig. 2A).

 

Heat inactivation of the bacteria abolished the effect of Berberine (Fig. 2A, insert), indicating that the bacteria produced butyrate. Then, eight standard strains of intestinal bacteria were individually treated with Berberine under anaerobic conditions to validate its effect on butyrate.

 

As shown in Fig. 2B, six out of the eight strains increased their butyrate production after Berberine treatment for 24 h (10 μg/mL, *P < 0.05 or **P < 0.01), with the highest increase seen in L. acidophilus ATCC 4356 and the lowest in E. coli ATCC 25922.

Further, we carried out the investigation in hamsters. Feeding healthy hamsters a HFD for 6 weeks significantly decreased the butyrate level in their feces and plasma by 24% and 44%, respectively (Fig. 2C); and at the same time, TC, TG, and LDL-C increased in the hamsters (***P < 0.001 for all three; Fig. 2C).

Treating the HFD-hamsters with Berberine (orally, 100 mg/kg/d) for 10 days increased butyrate in their feces and plasma by 1.8- and 2.5-fold (Fig. 2D), respectively, verifying the butyrate-increasing effect of Berberine in vivo. Accordingly, TC, TG, and LDL-C significantly decreased in HFD-hamsters, as compared to that before treatment (Fig. 2D; ***P < 0.001 for all three).
3.2. Increasing butyrate production in the gut microbiota is a newly discovered mechanism of Berberine in reducing blood lipid and glucose levels

To elucidate the role of butyrate, obese ob/ob mice were treated directly with an oral administration of butyrate (sodium), using Berberine as a reference. As shown in Fig. 3A & B, butyrate increased in the feces and blood in a time- and dose-dependent manner, indicating an efficient absorption and excellent bioavailability in vivo. Berberine treatment revealed a positive effect on butyrate production similar to that observed in the HFD-hamsters (Fig. 2C & D). In an inverse correlation with the level of blood butyrate, blood TC, TG, and FBG went down in the ob/ob mice treated with butyrate (Fig. 3C, D, & E). This reduction positively correlated with the dosage of butyrate and the treatment time (Fig. 3C, D, & E), demonstrating the regulatory effect of butyrate on the metabolism of lipids and glucose.

Although the plasma butyrate level in the Berberine-treated ob/ob mice was lower than that in the mice directly treated with butyrate (Fig. 3B, *P < 0.05, day 7 and 10), the lipids and glucose-lowering efficacy of Berberine was, in general, higher than that of direct butyrate treatment (Fig. 3C, **P < 0.01 on day 10; Fig. 3E, **P < 0.01 on day 7 and 10). The results indicate that the butyrate mechanism played a role in lowering blood lipid and glucose levels, in addition to the direct action of the circulated Berberine.

To elucidate the direct effect of Berberine in a bacteria-free condition, we treated the ob/ob mice with ip Berberine. Berberine at 20 mg/kg/d was used for ip injection for 10 days, considering that the oral bioavailability of Berberine was below 10% [31], and oral Berberine (100 mg/kg/d) served as a reference. As shown in Fig. 3F, ip administration of Berberine (20 mg/kg/d) to the mice for 10 days did not increase the level of butyrate in the feces (Fig. 3F) or blood (Fig. 3F), but significantly lowered blood TC, TG, and FBG with an efficacy similar to that of an oral Berberine treatment (100 mg/kg/d; Fig. 3G).

Interestingly, although an oral administration of Berberine (100 mg/kg/d, for 10 days) showed a blood concentration 56% of the ob/ob mice ip treated with Berberine (20 mg/kg/d, for 10 days; Fig. 3G, insert), its therapeutic efficacy was almost equal to that of the ip injection, probably because it caused a significant increase of butyrate in the blood (Fig. 3F; *P < 0.05 on day 7, ***P < 0.001 on day 10).

 

The results indicate that the overall lipid and glucose-lowering effects of orally administered Berberine represent a synergistic effect of at least two mechanisms. The first one correlates to the direct effect of circulated Berberine on cellular targets (such as LDLR, InsR, AMPK, and PCSK9), and the second relates to the Berberine that remains in the intestines and works through the gut microbiota metabolites, such as butyrate. As butyrate did not increase the expression of LDLR and InsR in hepatocytes (Fig. 3H), the two mechanisms appear to operate independently.

We found that body weights of the Berberine-treated ob/ob mice were significantly lower than those of the control mice on day 10 (**P < 0.01). In addition, the food intake of the Berberine-treated ob/ob mice slightly decreased but remained close to that of the control (Fig. S1). The results show an improvement in energy metabolism by Berberine.

3.3. Inhibition of the gut microbiota by antibiotics attenuated the effect of Berberine on butyrate
To further explore the significance of the gut microbiota from the Berberine treatment, antibiotics were used to create PGF ob/ob mice, based on previously described methods [30]. The ob/ob mice were orally pre-treated with antibiotics for 3 days (see Methods), followed by Berberine treatment with or without simultaneous administration of the antibiotics. The day 10 results are shown in Fig. 4.

Intestinal bacteria colony numbers in the PGF ob/ob mice treated with both Berberine and antibiotics were significantly lower than that of ob/ob mice treated with Berberine alone, with bacterial colony numbers reduced by 57% (0.4 logs; Fig. 4A).
Butyrate concentrations in the feces and plasma of the mice were examined.

 

As shown in Fig. 4B, on day 10, the level of butyrate in either feces or the blood of the Berberine-treated mice reduced by more than 30% as a result of antibiotic administration. With respect to the therapeutic efficacy of Berberine on conventional ob/ob mice (with no antibiotics), treating ob/ob mice orally with antibiotics before and during treatment largely decreased the therapeutic efficacy of Berberine on TC by 44% *(1− (100–82)/(100–68))× 100%+, TG by 41% *(1− (100–84)/(100–73))× 100%] and FBG by 46% *(1−(100–81)/(100–65))× 100%] (Fig. 4C, D, & E).

 

It seemed that an oral administration of antibiotics suppressed intestinal bacteria communities, and, accordingly, decreased butyrate production in the intestinal track, leading to a reduced therapeutic efficacy of Berberine on blood lipid and glucose levels. In addition, the antibiotic-induced reduction of Berberine absorption could also be a reason for the decline of the treatment effect [30].

 

Treating ob/ob mice with antibiotics alone for 10 days decreased TG and FBG to some degree in the mice, although the differences between the untreated control and antibiotic-treated group were not statistically significant; antibiotic treatment did not change TC in the ob/ob mice (Fig. 4C, D, & E).

3.4.Berberine upregulated butyrate synthesis and increased the abundance of the butyrate-producing bacteria
Butyrate is one of the main non-gaseous fermentation end products in anaerobic microbial communities. In this metabolic pathway, two molecules of acetyl-CoA are assembled to form acetoacetyl-CoA. After going through the intermediate steps of ß-hydroxybutyryl-CoA and crotonyl-CoA, the acetoacetyl-CoA is converted to
butyryl-CoA, which transforms to butyrate via the phosphotransbutyrylase 23
(PTB)/BUK pathway or the BUT pathway [15, 35]. In the present study, we found that an incubation of the gut microbiota with Berberine for 12 h largely decreased ATP production (***P < 0.001, for both low and high concentrations of Berberine). A significant early decline in ATP was found 6 h after Berberine treatment (20 μg/mL, **P < 0.01, Fig. 5A) as well. Paralleled with the ATP decline was an increase of AMP (Fig. 5A insert). The results were consistent with that of the Berberine found in the mitochondria of mammalian cells [27].

The reduction of ATP increased the expression of PTB/BUK and BUT [16] (Fig. 5B & C), both of which then expedited the transformation from butyryl-CoA to butyrate (Fig. 5D). The upregulatory effect on the expression of BUT and PTB/BUK were evidenced in the C. butyricum treated with Berberine (Fig. 5B insert & 5C insert). It should be mentioned here that as the PTB and BUK utilize one co-operator in transcription [35], the two enzymes were analyzed in the quantitative real time RT-PCR as one unit [34] (see Methods).

 

Although forming butanol is another metabolic direction of butyryl-CoA if the NADH level is high [16], we found butanol levels unchanged in Berberine treatment (Fig. 5E). In fact, Berberine reduced the level of NADH in the intestinal bacteria, with a decline of NADH/NAD+ ratio by 37.8% when Berberine was at 20 μg/mL (Fig. 5F, **P < 0.01). In addition, crotonyl-CoA and butyryl-CoA, the precursors of butyrate, were elevated, respectively, by Berberine (***P < 0.001, in 6 h), and the elevation continued to be significant for 12 h (**P < 0.01, Fig. 5G; Fig. 5H).

The increase of the two butyrate precursors might help the intestinal bacteria to uphold the production of butyrate in the Berberine treatment (Fig. 6A).
Besides the biochemical processes mediated by the bacterial enzymes mentioned above, the intestinal bacterial composition was analyzed. The ob/ob mice were treated orally with Berberine (100 mg/kg/day) for 10 days and their feces sample was taken for the bacterial composition analysis. The barcoded pyrosequencing of the V3 and V4 regions of the 16S rRNA gene showed that Berberine enriched the abundance of butyrate-producing bacteria in mice intestines. The heat-map of the top 50 bacterial genera that exhibited the most substantial change in abundance after exposure to Berberine is shown in Fig. 6B.

 

Of the 50 genera, the abundance of 9 genera increased after Berberine treatment. Seven of the nine genera were able to produce butyrate, including Enterobacter [36], Escherichia−Shigella [37], Incertae sedis [38], Lachnospiraceae FCS020 group [38], Akkermansia [39], Clostridium sensu stricto 1 [40], and Bacteroides [41], with the biggest increase seen in Enterobacter and Escherichia−Shigella (Fig. 6B). As Berberine showed only a minor inhibitory effect on intestinal bacteria in mice on day 10 post-treatment (Fig. 4A), the increased abundance of the butyrate-producing bacteria by Berberine represents a favorable action of the drug on these bacteria.

 

4. Discussion
The physiological role of the microbial-mammalian axis is becoming increasingly attractive. Metabolites from functioning intestinal microbiota, such as SCFAs and vitamins, are part of the organic chemical composition of human blood [42-44] and distributed throughout the organs, contributing to overall well-being [45].

 

The results presented in this study demonstrate that modulating gut microbiota production of butyrate by Berberine increase the level of butyrate in blood, as well as in liver (Fig. S2).
Butyrate is an important member of the SCFA family. The effect of SCFAs in tissues is mainly mediated through the function of its cellular receptors, free fatty acid receptor 2 (FFAR2) or free fatty acid receptor 3 (FFAR3), which are both G protein-coupled receptor (GPCR) proteins [46, 47] on the cell surface. FFAR3 linked with the pertussis toxin-sensitive Gi/o family participates in the SCFA-induced leptin production in adipose tissue, as well as lipid metabolism regulation. Whereas FFAR2 couples with either the Gi/o or pertussis toxin-insensitive Gq family and is involved in inflammation, glucagon-like peptide 1 (GLP-1) secretion, and body energy regulation [47-49].

In fact, Gao et al. showed that butyrate treatment could prevent obesity and insulin resistance, and the mechanism is related to promotion of energy expenditure and induction of mitochondrial function [50]. Clinical studies have shown that oral Berberine treatment increased insulin sensitivity and glucose disposal rates in patients with type 2 diabetes [18, 20].

Besides butyrate, Berberine treatment stimulated the gut microbiota to produce propionate as well (Fig. 1A), which entered the blood (Fig. S3) and showed bioactivities similar to that of butyrate [2]. The Berberine-induced metabolite profile of the gut microbiota is now under investigation in our laboratory. The functional metabolites from the gut microbiota could be considered drug messengers that enter the blood and exert the therapeutic effects of the original drugs that are poorly absorbed in the intestines, for instance, Berberine.

The increased abundance of butyrate-producing bacteria could be a reason for the elevation in butyrate production. One of the possible explanations is that Berberine might have a selective influence on some of the intestinal bacteria [33]; however, the detailed underlying mechanism remains unclear. As the elevated level of butyrate was verified in individual bacterial strains treated with Berberine in vitro, we were curious about the biochemical mechanism and found the PTB/BUK and BUT enzymes important in upregulating butyrate production.

Although bacterial PTB/BUK and BUT enzymes seemed to be involved in the mechanism, a gene knockout experiment was not performed in the present study. This is because it has been reported that PTB/BUK gene knockout mutants showed no decrease in butyrate production in C. tyrobutyricum [51], as butyrate is an end product of the energy metabolism network in bacteria (Fig. 6A). Therefore, the molecular mechanisms involved in Berberine-mediated increase of butyrate in bacteria need further investigation.

Although the presented work investigates the role of the gut microbiota in the mode of action of Berberine, the finding is of particular significance to herbal medicines, because herbal chemicals are often poorly absorbed in the intestines [52, 53].

Herbal derivatives such as glycosides, alkaloids, flavonoids, and polysaccharides have been investigated for decades and have been reported to be active for certain diseases in patients (or in animals) via oral administration [17, 54-56].

However, the intestinal absorption rates for many of the phytochemicals are very poor and their blood and organ concentrations are low [31, 57-59], raising questions on their therapeutic efficacy observed in patients. The phenomena could not be explained by the current theory of oral drug bioavailability, which was established fundamentally on the evaluation of drug absorption through the intestines [60].

The therapeutic effect of the functional metabolites from the gut microbiota could be a sound justification for the discrepancy. In addition, as the composition of the gut microbiota differs from patient to patient, the clinical efficacy of drugs might be different.

It suggests that the interaction between drug and the gut microbiota might be considered as part of the investigation on personalized medicine. In fact, genetic background, antimicrobials, diet, and physical exercise modulate the composition of intestinal bacteria [30, 61, 62] and, therefore, might influence the therapeutic efficacy of orally administered botanical chemicals poorly absorbed in the intestines.

In the view of drug discovery, orally administrated drugs, which are poorly absorbed and work through bacterial functional metabolites, might be attractive. First, these drugs might have a decreased chance of causing adverse effects in patients, as they hardly enter the blood circulation.

Second, drug stability in the blood, structural modification by hepatic CYP450, and tissue accumulation, which are often significant concerns for chemical drugs, do not seem to be critical for the drugs working through the gut microbiota.

Through anaerobic fermentation, intestinal microbiota could produce various metabolites that are of great potential in pharmacology, such as SCFAs [10, 43], making the gut microbiota a built-in factory synthesizing drug-like substances.

Discovering bioactive metabolites from the gut microbiota and understanding the control of their production in bacterial fermentation might open a new avenue in drug development.

Leave a Reply

Your email address will not be published.

Optimization WordPress Plugins & Solutions by W3 EDGE